Restriction Endonucleases

Restriction enzymes	Restriction enzymes are classified as endonucleases. Their biochemical activity is the hydrolysis ("digestion") of the phosphodiester backbone at specific sites in a DNA sequence. By "specific" we mean that an enzyme will only digest a DNA molecule after locating a particular sequence. Here's an example: There is an enzyme called BamHI that searches for the sequence GGATCC in double-stranded DNA (by which I mean that the bottom strand is also present): When the sequence is located, the enzyme BamHI digests the phosphodiester backbone in two specific places - between the pair of G nucleotides on each strand. That leaves us with a four nucleotide single stranded 5' end on each side after separation. 5'-GGATCC-3' Bam HI 5'-G -3' + 5'- GATCC-3' 3'-CCTAGG-5' ----> 3'-CCTAG -5' 3'- G-5'
	In reality there are more than six nucleotides on each strand, of course. The Bam HI just looks for the specific sequence it's interested in, and will accept no substitutes: GAGGATACCACCAGGGTTACAGGATAGGAGTCAGGATCCAGAGGACCTAGGATACCTC CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAGGTCTCCTGGATCCTATGGAG is digested by Bam HI (at the site shown in red) to give two fragments of DNA... GAGGATACCACCAGGGTTACAGGATAGGAGTCAG GATCCAGAGGACCTAGGATACCTC CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAG GTCTCCTGGATCCTATGGAG Restriction enzymes hydrolyze the phosphodiester backbone once on each strand (we say the strand is "nicked," perhaps to indicate that the cut isn't very deep). The bonds being broken by the enzyme are covalent. The hydrogen bonds responsible for base pairing are not broken by the restriction enzyme (however thermal energy is high enough at room temperature to separate BamHI fragments, for example).
Requirements	What does a restriction enzyme need in order to do its duty? 1. A double-stranded DNA sequence containing the recognition sequence. 2. Suitable conditions for digestion. For example, BamHI has the recognition sequence: GGATCC and requires conditions similar to this: 10 mM Tris-Cl (pH 8.0) 5 mM Magnesium chloride 100 mM NaCl 1 mM 2-mercaptoethanol Reaction conditions: 37 Restriction enzyme names are based on a species-of-origin. For example: BamHI (from Bacillus amyloliquifaciens (H)) Sma I (from Serratia marcescens S) Mlu I (from Micrococcus luteus) Hpa I (from Haemophilus parainfluenzae) From what species do you think EcoRI is derived?
	Let's suppose that we use the enzyme BamHI to digest DNA, as in the previous example. The enzyme finds the sequence GGATCC on each strand (note that it reads the same on the complementary strand and so we say the sequence has a two-fold axis of symmetry, or is "palindromic") and nicks the phosphodiester backbone between the G nucleotides. The hydrogen bonds break naturally, from the energy of thermal motion in the solution (the word we use to describe this loss of base pairing is to say the strands "melt"), and the two fragments move away from each other. 5'-GAGGATACCACCAGGGTTACAGGATAGGAGTCAG-3' 3'-CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAG-5' and 5'-GATCCAGAGGACCTAGGATACCTC-3' 3'-GTCTCCTGGATCCTATGGAG-5' The two fragments have newly-exposed 5' and 3' ends. (And nearly all restriction enzymes leave a phosphate on the exposed 5' end. The enzyme Nci I, an exception to the rule, leaves a 3' phosphate).
More on recognition sequences	Consider three enzymes with recognition sequences as indicated (a caret symbol (^) or asterisk (*) is often inserted to mark the place where the enzyme breaks the phosphodiester backbone) Enzyme Recognition sequence Type of ends in product BamHI G^GATCC 5' overhang SacI GAGCT^C 3' overhang SmaI CCC^GGG blunt It is important that you recognize the differences between the three types of ends generated by restriction enzymes, and the three examples above are illustrative. In the example of digestion with the enzyme BamHI, it's obvious that the newly created ends of the DNA do not line up evenly with each other. On each fragment, there is a four-nucleotide sequence 5'-GATC that hangs off the end and doesn't base-pair (because the other fragment has broken away and moved off). Since the one end that hangs over past the other has a free 5' end, we say that BamHI digestion creates a "5' overhanging end" which we sometimes call a "5' overhang." Another term that means the same thing is to say that overhanging ends are "cohesive ends" or "sticky ends" meaning that they could hydrogen bond to other compatible complementary strands (compatible in the sense of Watson-Crick base pairing). By our usual convention of writing DNA, a 5' overhanging end has a characteristic shape. Some restriction enzymes leave a 3' overhanging end. An example would be the enzyme Sac I: Sac I searches for the sequence GAGCTC on each strand (once again, GAGCTC reads the same off of both strands because the sequence is palindromic). The enzyme breaks the phosphodiester bonds between the fifth and sixth nucleotides in the recognition sequence. 5'-GAGCTC-3' Sac I 5'-GAGCT -3' + 5'- C-3' 3'-CTCGAG-5' ----> 3'-C -5' 3'- TCGAG-5' Some restriction enzymes leave a blunt end. What do we call a DNA molecule that has ends that line up evenly with each other (i.e. neither end is overhanging)? We say the ends are "blunt" (meaning "not sharp") or "flush" (meaning "level or even"). For example, the enzyme Sma 1 cuts in the middle of the six nucleotide recognition sequence: 5'-CCCGGG-3' Sma I 5'-CCC -3' + 5'- GGG-3' 3'-GGGCCC-5' ----> 3'-GGG -5' 3'- CCC-5' Not all restriction enzymes recognize sequences that are palindromic. For example, the enzyme Bsr I cuts as follows (where "N" can represent any nucleotide): 5'-ACTGGNN-3' Bsr I 5'-ACTGGN N-3' 3'-TGACCNN-5' ----> 3'-TGAC CNN-5' Some restriction enzyme sequences cut outside of their recognition sequence Mnl I CCTCNNNNNNN^ GGAGNNNNNNN^ What type of DNA end does Mnl I leave? Eco57I CTGAAGNNNNNNNNNNNNNNNN^ GACTTCNNNNNNNNNNNNNN^ ...sometimes written CTGAAG (16/14) Ksp632I CTCTTCN^ GAGAAGNNNN^ Some enzymes have split recognition sequences Consider the enzyme Asp 700, with the restriction enzyme recognition sequence: GAANN^NNTTC The 6 nucleotides of recognition sequence is split - palindromic, with the four internal nucleotides not specified. What type of end does Asp 700 leave? Can you figure out how the enzyme Dra III cuts, from the recognition sequence: CAC(N3)^GTG ? Would the overhanging end left by Dra III be the same at every site? Some enzymes accept degenerate sequences We've been using "N" nucleotides in our recognition sequences, but the N is obviously non-specific. There are enzymes that have partial degeneracies in their recognition sequence. An example of this is Aha II, recognizing the sequence GR^CGYC, where R = G or A, and Y = T or C. For Aha II then, the following are all acceptable recognition sequences: GG^CGCC GA^CGCC GG^CGTC GA^CGTC Additional examples follow: Hind II GTY^RAC Hae II RGCGC^Y DraII RG^GNCCY Not all restriction enzymes recognize six-nucleotide pair sequences. Enzymes with recognition sequences from 4 to 8 nucleotides in length each have uses in genetic engineering. 6-cutters (i.e. enzymes that have recognition sequences specified by six nucleotides) are good for day-to-day cloning work: You are using 6-cutters in the experiments you are performing in the lab, because they cut frequently enough that there are one or two sites in the plasmid, but infrequently enough that they do not cut into the essential elements such as the origin of replication or ampicillin resistance gene. An example of a 6-cutter is HindIII (A^AGCTT) which cuts the genome of bacteriophage lambda (48 kbp) at 7 sites. 8-cutters are good for carving up chromosomes into specific pieces that are still quite large. PacI might cut the E. coli chromosome into only about 20 pieces, for example, whereas BamHI might cut it into about 300 pieces. Example of where an 8 cutter might be of use: Suppose you were trying to obtain a specific fragment of a yeast chromosome, for example. Then, it would be impractical to use a 6-cutter enzyme because you would generate too many small fragments during your digestion. An 8-cutter might cut infrequently, generating larger and more useful products. An example of an 8-cutter is NotI (GC^GGCCGC) - the NotI recognition sequence is not present in the genome of bacteriophage lambda. 4-cutters are good for experiments where you want the possibility of cleavage at many potential sites. For example, if you want to gather a collection of random DNA fragments, some of which may contain a gene you want, you can perform a partial digestion (not all sites are cleaved due to limitation in enzyme activity) using a 4-cutter. One that is commonly used for this purpose is Sau3AI, which cleaves: 5'-NGATCN-3' Sau3AI 5'-N GATCN-3' 3'-NCTAGN-5' ----> 3'-NCTAG N-5' There are 116 Sau3AI sites in the genome of bacteriophage lambda.